Human Reproducrion



Patient Story
Successful heart surgery at We Care India partner hospital allows Robert Clarke to live a normal life despite a rare genetic disorder We Care india helped Robert find best super specialised surgeon for his rare condition.

Read    : Robert's Story
See All : Success Stories

Home > Treatments > Human Reproducrion                            Bookmark and Share Go Back Print This Page Add to Favorites

 


Overview

 


The risk for a pregnancy with aneuploidy (too many or too few chromosomes, such as Down syndrome) increases with maternal age. Following a chromosomally abnormal pregnancy, the risk for a similar problem to occur again in any subsequent pregnancy is elevated regardless of maternal age. For some couples at an elevated risk, it may be difficult to consider conceiving a future pregnancy. PGD for aneuploidy minimizes the likelihood of a chromosome abnormality in a future pregnancy and increases the chance of achieving an ongoing successful pregnancy.


What is DNA ?

DNA (deoxyribose nucleic acid) is a code inside cells to tell the body what it needs to function and what to look like. The code is made up of 4 different chemical units called bases. The bases are adenine (A), thymine (T), guanine (G) and cytosine (C). The code, if you were to read it, would look something like this:

...CGTAGCTTACTTTAGGCTAGCAAACGCATC....

A gene is a small section of the code (though much longer than this example) that can be decoded by the cell to mean something. A single gene might be responsible for any aspect of your body's function or appearance, like making a certain protein, or the colour of your eyes.

If there is an error in the code for a gene the product will be faulty (see genetic mistakes). When a cell divides, identical copies of the DNA must be made and distributed evenly into the new cells e.g. when a baby is developing or when we make new blood or skin cells. The copied DNA is packaged into chromosomes and each cell receives an identical copy of each chromosome.

^ Back to Top

What are Chromosomes?

Genetic Treatment India,India Genetics Infertility Disorders, Genetic Infertility

Packaging the DNA into chromosomes ensures that the genetic material is copied and distributed evenly when a cell divides. Chromosomes can only be seen under the microscope when a cell is dividing.

Long strings of DNA, containing hundreds of genes each, coil up in the form of chromosomes. In normal human cells there are 46 chromosomes There is one pair of sex chromosomes (two X chromosomes for females and one X and one Y chromosome for males) and 22 pairs of autosomes (non-sex chromosomes) numbered 1-22.

When a cell divides the DNA is copied and 1 copy of each chromosome is distributed into each new cell (mitosis). The new cells are an identical copy of the previous cell. When producing sperm and eggs, the cells divide so that there are only 23 chromosomes - one of each pair (meiosis).

At fertilization, the chromosomes from the sperm and egg come together to give a new full complement of 46 chromosomes in the embryo. Usually the DNA is copied exactly and the chromosomes are distributed perfectly, but sometimes errors are made by the cell.


Genetic Mistakes


Gene errors
Sometimes mistakes can happen in the copying of the code when a cell divides:


Gene deletion
A section of the DNA can be missed out
GTCAACTGATCGATCGGATCGA
GTCAAC___TCGATCGGATCGA


Gene mutation
The wrong base might be copied
GTCAACTGATCGATCGGATCGA
GTCAACTGCTCGATCGGATCGA

Once these errors are made, the gene may be faulty and not function properly. It may cause a genetic disease, such as cystic fibrosis. The faulty gene will be copied exactly and can be passed down from generation to generation.


Chromosome errors

^ Back to Top
Chromosome loss or gain.

Genetic Infertility, Genetic Treatment And Technologies,  Genetic Infertility Treatment
When a cell is dividing, sometimes a whole chromosome can end up in the wrong cell, so that the cell has the wrong number of chromosomes (aneuploidy). One cell will have one too many chromosomes (chromosome gain) and one will have one too few (chromosome loss).

If there is an extra chromosome, the cells have extra DNA and if there is one missing there will be less. This is rather like having either too many or not enough ingredients for a recipe.

These mistakes can happen when any cell is dividing but if they occur during the formation of sperm and eggs cells, it will affect the genetic makeup of the embryo.

You may be familiar with Down syndrome that is caused by having an extra copy of chromosome 21. This gives 3 copies in total and Down syndrome is sometimes called trisomy 21


Chromosome Rearrangement


Genetic Treatment India,Genetic Infertility, Genetic Treatment And Technologies


Pieces of chromosomes can sometimes be rearranged, so that one piece of a chromosome is stuck on another (translocation) A handy way to think about this is if you imagine that you have two complete sets of Encyclopaedia Britannica in your house, stored in a very orderly fashion.

If, for some reason, the order of the two sets of books is rearranged, it doesn't bother you, because you still have 2 copies of all the volumes.






^ Back to Top

For more information, medical assessment and medical quote

as email attachment to

Email : - info@wecareindia.com

Contact Center Tel. (+91) 9029304141 (10 am. To 8 pm. IST)

(Only for international patients seeking treatment in India)

 

Request Information

 

Gender :

      

 

  

              





Copyright © 2010 We Care India. All rights reserved.
Registered Office: 103, Gaurav Philips, Near Rishi Complex, Holy Cross Road, IC Colony, Boriwali (West) Mumbai - 400103 Phone Number : +91 9029304141
Registered Office Delhi : - IB/5B, Phase - 1, Ashok Vihar, Delhi - 110052, India.

Genetic Treatment, Genetic Treatment India, Cost Genetic Treatment India,Genetic Treatment And Technologies, Biology Genetics Medicine, Genetic Treatment Center India, Genetic Treatment Doctors Bangalore India, Genetic Treatment Surgeon Mumbai India, Health Cancer, Biology Genetics , Genes , Health Cancer, Embryo, Gene Therapy, Genetic Disease, Genome, Hgp, Human Genetics, Ethics, Fetal, Genetic, Genomic Medicine, Pharmacogenetics, Genetic Treatment Hospitals India, Reproductive, Screening, Genetic Treatment Price India, Genetic Therapy, Human Genomics, Molecular Medicine, Genetic Disorder Treatment, Genetic Treatment Of Depression, Medicine, Mental Treatment Services, Genomics, Genetic Testing, Genomic Medicine, Genetic Counseling, Medical